Basic Statistics
| Measure | Value |
|---|---|
| Filename | cond2rep2_S5_L002_R1_001.fastq.bz2 |
| File type | Conventional base calls |
| Encoding | Sanger / Illumina 1.9 |
| Total Sequences | 1829940 |
| Sequences flagged as poor quality | 0 |
| Sequence length | 75 |
| %GC | 48 |
Per base sequence quality
Per tile sequence quality
Per sequence quality scores
Per base sequence content
Per sequence GC content
Per base N content
Sequence Length Distribution
Sequence Duplication Levels
Overrepresented sequences
| Sequence | Count | Percentage | Possible Source |
|---|---|---|---|
| TATATTAATTTCATCTGAAGACGTCCTCCACTCATGAGCAGTCCCCTCCCTAGGACTTAAAACTGATGCCATCCC | 5160 | 0.2819764582445326 | Search with Blastn,more detail First hit on +100: Mus musculus mitochondrial DNA from Lewis lung carcinoma, complete sequence Evalue=3.3219e-33, Ident=100%, QueryCovergap=0% |
| AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAG | 3341 | 0.18257429205329134 | TruSeq Adapter, Index 5 (100% over 63bp) |
| TGACGTGCAAATCGGTCGTCCGACCTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTC | 2460 | 0.13443063707006786 | Search with Blastn,more detail First hit on +100: PREDICTED: Cavia porcellus collagen alpha-1(I) chain-like (LOC100717127), mRNA Evalue=3.3219e-33, Ident=100%, QueryCovergap=0% |
Adapter Content
Kmer Content
| Sequence | Count | PValue | Obs/Exp Max | Max Obs/Exp Position |
|---|---|---|---|---|
| CGTAT | 3290 | 0.0 | 10.034815 | 45 |
| TCGTA | 3505 | 0.0 | 9.216705 | 44 |
| CGTCC | 6220 | 0.0 | 8.903414 | 22 |
| CTAGG | 7205 | 0.0 | 8.228199 | 50 |
| TATAT | 11195 | 0.0 | 7.395739 | 1 |
| GACGT | 7770 | 0.0 | 7.1730022 | 20 |
| CCTAG | 8700 | 0.0 | 6.9774895 | 49 |
| TAGGA | 9700 | 0.0 | 6.2947583 | 51 |
| GGTCG | 4105 | 0.0 | 6.2264667 | 14 |
| CCCTA | 9975 | 0.0 | 6.156807 | 48 |
| ACTTA | 9405 | 0.0 | 6.152493 | 55 |
| GCCGT | 5200 | 0.0 | 6.1441455 | 50 |
| GTCCG | 4060 | 0.0 | 6.120605 | 18 |
| AATCG | 4190 | 0.0 | 6.100154 | 10 |
| AGACG | 9395 | 0.0 | 6.083471 | 19 |
| TCTCG | 5670 | 0.0 | 6.073108 | 42 |
| ATATT | 12445 | 0.0 | 6.0188 | 2 |
| TATTA | 9865 | 0.0 | 5.9735613 | 3 |
| CGATA | 2930 | 0.0 | 5.936778 | 58 |
| GTCGT | 4390 | 0.0 | 5.8222427 | 15 |
Bad tiles
No bad tiles