Basic Statistics
| Measure | Value |
|---|---|
| Filename | cond2rep2_S5_L004_R1_001.fastq.bz2 |
| File type | Conventional base calls |
| Encoding | Sanger / Illumina 1.9 |
| Total Sequences | 1847516 |
| Sequences flagged as poor quality | 0 |
| Sequence length | 75 |
| %GC | 48 |
Per base sequence quality
Per tile sequence quality
Per sequence quality scores
Per base sequence content
Per sequence GC content
Per base N content
Sequence Length Distribution
Sequence Duplication Levels
Overrepresented sequences
| Sequence | Count | Percentage | Possible Source |
|---|---|---|---|
| TATATTAATTTCATCTGAAGACGTCCTCCACTCATGAGCAGTCCCCTCCCTAGGACTTAAAACTGATGCCATCCC | 5266 | 0.28503136102745524 | Search with Blastn,more detail First hit on +100: Mus musculus mitochondrial DNA from Lewis lung carcinoma, complete sequence Evalue=3.3219e-33, Ident=100%, QueryCovergap=0% |
| AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAG | 3173 | 0.17174411480062962 | TruSeq Adapter, Index 5 (100% over 63bp) |
| TGACGTGCAAATCGGTCGTCCGACCTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTC | 2465 | 0.13342238984669144 | Search with Blastn,more detail First hit on +100: PREDICTED: Cavia porcellus collagen alpha-1(I) chain-like (LOC100717127), mRNA Evalue=3.3219e-33, Ident=100%, QueryCovergap=0% |
Adapter Content
Kmer Content
| Sequence | Count | PValue | Obs/Exp Max | Max Obs/Exp Position |
|---|---|---|---|---|
| CGTCC | 5990 | 0.0 | 8.652728 | 22 |
| CGTAT | 3280 | 0.0 | 7.251306 | 45 |
| CTAGG | 7275 | 0.0 | 7.1731744 | 50 |
| GTCCG | 4165 | 0.0 | 7.074408 | 18 |
| CGAAC | 4145 | 0.0 | 6.8516073 | 50 |
| GGTCG | 4190 | 0.0 | 6.693115 | 14 |
| TATAT | 10945 | 0.0 | 6.6511145 | 1 |
| TCGTA | 3510 | 0.0 | 6.573876 | 44 |
| GTCGT | 4845 | 0.0 | 6.5209594 | 15 |
| GCGAA | 4440 | 0.0 | 6.476156 | 37 |
| TCGGT | 4655 | 0.0 | 6.4058223 | 12 |
| AATCG | 4615 | 0.0 | 6.3075023 | 10 |
| TCGAA | 4790 | 0.0 | 6.299563 | 49 |
| CGGTC | 4760 | 0.0 | 6.1899395 | 13 |
| CCTAG | 8775 | 0.0 | 6.1897244 | 49 |
| GACGT | 8230 | 0.0 | 6.168268 | 20 |
| GGCGA | 5495 | 0.0 | 5.8788037 | 36 |
| TATTA | 9685 | 0.0 | 5.7555366 | 3 |
| CCCTA | 9940 | 0.0 | 5.678554 | 48 |
| TCGTC | 5890 | 0.0 | 5.6653643 | 16 |
Bad tiles
No bad tiles